| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237241 |
| Chromosome: | chromosome 6 |
| Location: | 3795155 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278163 | ARG9 | (1 of 1) 2.6.1.11 - Acetylornithine transaminase / Succinylornithine aminotransferase; Acetylornithine aminotransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCATGATTTGCAAGCTCTTGCACATCGG |
| Internal bar code: | GTCGTCGCGGTCGCCCCAACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 618 |
| LEAP-Seq percent confirming: | 99.2182 |
| LEAP-Seq n confirming: | 2665 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGCAAGAGCCAGACAAAC |
| Suggested primer 2: | GGTGTCTGAGAGTGGGGTGT |