| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.237244 |
| Chromosome: | chromosome 1 |
| Location: | 1643726 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g008650 | CDK1 | Cyclin-dependent kinase; (1 of 12) 2.7.11.22//2.7.11.23 - Cyclin-dependent kinase / Cdk-activating protein kinase // [RNA-polymerase]-subunit kinase / CTD kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCTGCTCCACATGCCTTTGCGCGCCGT |
| Internal bar code: | CATGCATTGCGATCATGACTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1338 |
| LEAP-Seq percent confirming: | 97.3697 |
| LEAP-Seq n confirming: | 4035 |
| LEAP-Seq n nonconfirming: | 109 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGCAAAGCTTCCGTTTC |
| Suggested primer 2: | AGGTAGGCAGGCAGGTAGGT |