Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.237272 |
Chromosome: | chromosome 11 |
Location: | 3261630 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g479850 | CYN59 | Cyclophilin 59; (1 of 1) K12735 - peptidyl-prolyl cis-trans isomerase-like 4 [EC:5.2.1.8] (PPIL4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTTGCCCGTGCGGCCGAACGGACTTGC |
Internal bar code: | GCACTGTGGGTGACACTCCTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 635 |
LEAP-Seq percent confirming: | 98.852 |
LEAP-Seq n confirming: | 775 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCTGCTGCTGATGGATG |
Suggested primer 2: | TCGGTCATGAACAACCAAAA |