| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.237272 |
| Chromosome: | chromosome 11 |
| Location: | 3261630 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479850 | CYN59 | Cyclophilin 59; (1 of 1) K12735 - peptidyl-prolyl cis-trans isomerase-like 4 [EC:5.2.1.8] (PPIL4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTTGCCCGTGCGGCCGAACGGACTTGC |
| Internal bar code: | GCACTGTGGGTGACACTCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 635 |
| LEAP-Seq percent confirming: | 98.852 |
| LEAP-Seq n confirming: | 775 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCTGCTGCTGATGGATG |
| Suggested primer 2: | TCGGTCATGAACAACCAAAA |