| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237279 |
| Chromosome: | chromosome 10 |
| Location: | 2997587 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440900 | RRP43 | Rrp42-like exosome component; (1 of 1) K12586 - exosome complex component RRP43 (RRP43, EXOSC8, OIP2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGACGGGCAGAGCCCCATTCAATTGTCC |
| Internal bar code: | CACCAGAACCACGGTTGACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 566 |
| LEAP-Seq percent confirming: | 99.2869 |
| LEAP-Seq n confirming: | 4873 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACGGGGTCTGTGTTAGTG |
| Suggested primer 2: | TGGTGCTCAGTGTGGAAATG |