| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.237297 |
| Chromosome: | chromosome 3 |
| Location: | 3578953 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168200 | C1b-135,FAP69 | Flagellar Associated Protein 69; (1 of 4) IPR000225//IPR011989//IPR016024 - Armadillo // Armadillo-like helical // Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGGAGAGGATGACTGATGATGAGCTGG |
| Internal bar code: | TAGGGGGACATACAATACCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 874 |
| LEAP-Seq percent confirming: | 99.2488 |
| LEAP-Seq n confirming: | 14137 |
| LEAP-Seq n nonconfirming: | 107 |
| LEAP-Seq n unique pos: | 135 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGTACGCCAAGTTCCGA |
| Suggested primer 2: | TGCACATGACTAGCAGGAGG |