| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.237333 |
| Chromosome: | chromosome 7 |
| Location: | 1587529 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g324800 | SNE6 | (1 of 8) PTHR10366//PTHR10366:SF411 - NAD DEPENDENT EPIMERASE/DEHYDRATASE // HIGH CHLOROPHYLL FLUORESCENCE PHENOTYPE 173 PROTEIN; Cinnamoyl-CoA reductase/flavanone 4-reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCACATCCTGCAATACGTCCGAAGCCT |
| Internal bar code: | CACGAGCTCAATTCGGGCTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 954 |
| LEAP-Seq percent confirming: | 99.3548 |
| LEAP-Seq n confirming: | 11549 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCCCTAAACTCTCGCTGC |
| Suggested primer 2: | TGCCATGTGGATGACGTAGT |