| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.237339 |
| Chromosome: | chromosome 7 |
| Location: | 2058888 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325812 | MAW1,ZYS2 | Membrane-associated hydroxyproline-rich glycoprotein 1; (1 of 80) IPR003882 - Pistil-specific extensin-like protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCATCCATCTCTATGGCCATGCGCAACG |
| Internal bar code: | CTGTGTCCAGGGCCGTGGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 98.024 |
| LEAP-Seq n confirming: | 9475 |
| LEAP-Seq n nonconfirming: | 191 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGCAAGAAGAAGTGAGC |
| Suggested primer 2: | TAGGTGGAGATGGGGATGTT |