Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.237410 |
Chromosome: | chromosome 7 |
Location: | 2419331 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g328850 | CNK8 | NimA-related protein kinase; (1 of 1) PTHR24361:SF240 - PROTEIN MTK-1, ISOFORM B | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAACAGCCCAACCACACACACCAAACAA |
Internal bar code: | TACATGGGACGATCTCTTAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 785 |
LEAP-Seq percent confirming: | 99.4775 |
LEAP-Seq n confirming: | 7045 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGCAAAGAAAGGTGGCTG |
Suggested primer 2: | CACAAGTATGCCCTGGGAGT |