| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237418 |
| Chromosome: | chromosome 17 |
| Location: | 4618060 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g733150 | HKR7,HKR78,HKR8,COP12HKR6,COP,COP11 | Histidine kinase rhodopsin 7/8; (1 of 1) PF00072//PF00512//PF01036//PF02518 - Response regulator receiver domain (Response_reg) // His Kinase A (phospho-acceptor) domain (HisKA) // Bacteriorhodopsin-like protein (Bac_rhodopsin) // Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (HATPase_c) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTTTGCAATCGGTACGATCTCAGGCAC |
| Internal bar code: | ATGTGTCAATGGGCGCGCCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 643 |
| LEAP-Seq percent confirming: | 99.2218 |
| LEAP-Seq n confirming: | 2040 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGATCAGCCGCCTATTCAA |
| Suggested primer 2: | CATACCGAGGGTAACACGCT |