Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.237506 |
Chromosome: | chromosome 17 |
Location: | 3997999 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g728900 | FSA1,TAL3 | (1 of 1) PTHR10683//PTHR10683:SF2 - TRANSALDOLASE // SUBFAMILY NOT NAMED; Transaldolase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTGGCGCCGTGGGGTGCAGCCGCAGTG |
Internal bar code: | GCCCGCGGGAAGGTAGCACAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 574 |
LEAP-Seq percent confirming: | 98.9946 |
LEAP-Seq n confirming: | 25107 |
LEAP-Seq n nonconfirming: | 255 |
LEAP-Seq n unique pos: | 138 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAGGGCAAACACGCTAAC |
Suggested primer 2: | ATGGCTGTTTCCCTTGACAC |