| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237524 |
| Chromosome: | chromosome 6 |
| Location: | 8083536 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304550 | PAN2,PAR1 | (1 of 1) K12571 - PAB-dependent poly(A)-specific ribonuclease subunit 2 (PAN2); Poly(A)-ribonuclease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAATTGACTGTTGAATGTTCAACACCA |
| Internal bar code: | GGACATCGGAGCATGCAAAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 570 |
| LEAP-Seq percent confirming: | 98.6928 |
| LEAP-Seq n confirming: | 906 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAGTACTGGTGTGGCTGG |
| Suggested primer 2: | CGGAGAAAAGTGGGGTTACA |