| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.237566 |
| Chromosome: | chromosome 14 |
| Location: | 243286 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609300 | (1 of 1) PTHR19288//PTHR19288:SF3 - 4-NITROPHENYLPHOSPHATASE-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATCACCCCCGCCCAGCTCCCTCGCCCT |
| Internal bar code: | CGGGTTTAACGGACGTCGACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 127 |
| LEAP-Seq percent confirming: | 90.8623 |
| LEAP-Seq n confirming: | 1412 |
| LEAP-Seq n nonconfirming: | 142 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTAAAGTCGAAACAGCC |
| Suggested primer 2: | CACGTACCTGAAACGGACCT |