| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237767 |
| Chromosome: | chromosome 13 |
| Location: | 3741322 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589450 | FBB6L1 | (1 of 1) IPR002035//IPR013694 - von Willebrand factor, type A // VIT domain; FBB6 like protein 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGTAGGAGATTACTTGCTCTTTGTAG |
| Internal bar code: | GGTGTATGCTGGTGCGCGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 609 |
| LEAP-Seq percent confirming: | 98.5325 |
| LEAP-Seq n confirming: | 470 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTAGCTGAACTCCACCG |
| Suggested primer 2: | AACATGCCTGGTTGTAAGCC |