| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.237771 |
| Chromosome: | chromosome 2 |
| Location: | 2548054 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092700 | FAP45 | Flagellar Associated Protein 45; (1 of 1) PTHR15504:SF0 - COILED-COIL DOMAIN-CONTAINING PROTEIN 19, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGCAATCCATGCTGGCCTCTACTCAAC |
| Internal bar code: | CCGTTGGCTCAGTCAAAGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1278 |
| LEAP-Seq percent confirming: | 97.9131 |
| LEAP-Seq n confirming: | 9806 |
| LEAP-Seq n nonconfirming: | 209 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGCAAGCTGGGTGATAAT |
| Suggested primer 2: | TCAATCTGTGCCTGCATCTC |