Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.237788 |
Chromosome: | chromosome 11 |
Location: | 3423234 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g480851 | RRA3 | (1 of 3) PTHR10994//PTHR10994:SF3 - RETICULON // ARABINOSYLTRANSFERASE; Reduced residual arabinose 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTTCTTCAGGTGCAGGGAGGGTGGGGCT |
Internal bar code: | ATCGCATTCGACGATACCAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 187 |
LEAP-Seq percent confirming: | 99.1723 |
LEAP-Seq n confirming: | 1318 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCTGTAGGTACCAGCCCA |
Suggested primer 2: | GTACAAGCAACCCACCTCGT |