| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237820 |
| Chromosome: | chromosome 13 |
| Location: | 2569413 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g580950 | GT90-25,GT90F25 | (1 of 11) 2.4.2.26 - Protein xylosyltransferase / Uridine diphosphoxylose-protein xylosyltransferase; GT90 family protein 25 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTTGTAGGCCAGCATTGGCCACGAGGGC |
| Internal bar code: | TATAACGAAGCTGCCGAGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 653 |
| LEAP-Seq percent confirming: | 98.5456 |
| LEAP-Seq n confirming: | 6098 |
| LEAP-Seq n nonconfirming: | 90 |
| LEAP-Seq n unique pos: | 104 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAGCCTAGCCCCTTACT |
| Suggested primer 2: | GTGTGGTCCCGACAAGAACT |