| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.237845 |
| Chromosome: | chromosome 9 |
| Location: | 2304870 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392250 | OTU5 | (1 of 2) IPR000104//IPR003323 - Antifreeze protein, type I // OTU domain; OTU-like cysteine protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCCGCCCTGCCCCGGACCACCACCTCA |
| Internal bar code: | ATGGTTACACGCGGATCTGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 180 |
| LEAP-Seq percent confirming: | 98.4685 |
| LEAP-Seq n confirming: | 2186 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCTGTACTTGCACGCAGC |
| Suggested primer 2: | CTAGCGCACAGTGCAGAGAC |