| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.237875 |
| Chromosome: | chromosome 5 |
| Location: | 878154 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247600 | UBC2 | (1 of 1) PTHR24067//PTHR24067:SF46 - UBIQUITIN-CONJUGATING ENZYME E2 // LD28904P; E2 Ubiquitin conjugating enzyme | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGGCGTAGCCCTGTGATTTATCGCGCGA |
| Internal bar code: | TGGGAGCTGATCTTATTGCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 977 |
| LEAP-Seq percent confirming: | 99.02 |
| LEAP-Seq n confirming: | 4547 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCTCTAATGCTTCACACA |
| Suggested primer 2: | AAAATGGAGGATTTTTGGGG |