Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.237883 |
Chromosome: | chromosome 7 |
Location: | 4038697 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g340200 | TEF3,PGRL1 | Proton-gradient related-like; (1 of 1) PTHR31032//PTHR31032:SF1 - FAMILY NOT NAMED // PGR5-LIKE PROTEIN 1A, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGGCGCCCGACTACGGTGTTTTATTGC |
Internal bar code: | CGAGTGGACGGCACCAGCAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 625 |
LEAP-Seq percent confirming: | 98.9932 |
LEAP-Seq n confirming: | 5211 |
LEAP-Seq n nonconfirming: | 53 |
LEAP-Seq n unique pos: | 93 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCGGACATGATCTTTGAC |
Suggested primer 2: | CGGGAACTAATTGTGGCAGT |