Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.237900 |
Chromosome: | chromosome 16 |
Location: | 1023345 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g649150 | (1 of 1) PF13414//PF13920 - TPR repeat (TPR_11) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCTGGGAACCCTTCCTATGCCCACCCG |
Internal bar code: | GTGTGCGTGACGCGTGGTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 604 |
LEAP-Seq percent confirming: | 99.2354 |
LEAP-Seq n confirming: | 3764 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCTTGCTAAGGGTAACAC |
Suggested primer 2: | CAAGGATGGTGGTGTGACTG |