Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.237937 |
Chromosome: | chromosome 10 |
Location: | 2032880 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g432800 | RPSA,RPSa | Ribosomal protein Sa, component of cytosolic 80S ribosome and 40 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCAGGCACCTCCCGTTCTCCACCAGA |
Internal bar code: | AAACCCGGCTGCGGTCGATCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 597 |
LEAP-Seq percent confirming: | 62.1622 |
LEAP-Seq n confirming: | 69 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGACAGGAGACATTTGCTCA |
Suggested primer 2: | CTGGTAATGCGTTCCTTGGT |