Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.237958 |
Chromosome: | chromosome 7 |
Location: | 6092317 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g355466 | AGE2 | DNA repair glycosylase; (1 of 1) PF15628 - RRM in Demeter (RRM_DME) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGAACTCAAGGACGCGGCAGAGGGCAA |
Internal bar code: | AGAAGTTAGGCATAAAAAACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 739 |
LEAP-Seq percent confirming: | 94.052 |
LEAP-Seq n confirming: | 10958 |
LEAP-Seq n nonconfirming: | 693 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGGTACCTCCTGGGTGT |
Suggested primer 2: | CAAATTATCAAGCCCCGCTA |