| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.237991 |
| Chromosome: | chromosome 16 |
| Location: | 1751900 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g654950 | SRR3 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTACGTTGGCGCCAAAGTAGGACCGGC |
| Internal bar code: | GAGAATCGGCTCGGCGCGCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 225 |
| LEAP-Seq percent confirming: | 89.2031 |
| LEAP-Seq n confirming: | 694 |
| LEAP-Seq n nonconfirming: | 84 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGGTCAATGGTCAGGGG |
| Suggested primer 2: | CAGGTTGGTTGGATGGATTC |