| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.237999 |
| Chromosome: | chromosome 6 |
| Location: | 5458877 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284450 | PPP24 | (1 of 2) K15731 - carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase [EC:3.1.3.16] (CTDSP); Phosphoprotein phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTAGGTCAGTCAGGTAGTCAAACGCACGT |
| Internal bar code: | GACCCGCGTTCTAAACACATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1062 |
| LEAP-Seq percent confirming: | 99.2258 |
| LEAP-Seq n confirming: | 769 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAATGGTTGCACAAGGGAC |
| Suggested primer 2: | CATGCCCGCAGTAGTATGTG |