| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.238009 |
| Chromosome: | chromosome 5 |
| Location: | 2239570 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234661 | BCS1 | Ubiquinol-cytochrome c reductase complex chaperone; (1 of 1) K08900 - mitochondrial chaperone BCS1 (BCS1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGATTGATGGGTAGAATGCTTTAGATAC |
| Internal bar code: | TAGACAGTCTGTAGCGGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 98.9341 |
| LEAP-Seq n confirming: | 1021 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGGAAAGATCCTCACCA |
| Suggested primer 2: | AATGACCGAACAGATCGAGG |