Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.238025 |
Chromosome: | chromosome 3 |
Location: | 5786185 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g188800 | Nicotinate phosphoribosyltransferase; (1 of 1) PTHR11098//PTHR11098:SF2 - NICOTINATE PHOSPHORIBOSYLTRANSFERASE // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACAAGGGAGCAGGGCGCTGCCGGGCGT |
Internal bar code: | AAACGGCAAACGCAAAGTCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 619 |
LEAP-Seq percent confirming: | 91.9075 |
LEAP-Seq n confirming: | 159 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCAGCTACCTCAGCCTCAA |
Suggested primer 2: | CACGAACTTCTCGAAGAGGG |