| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.238044 |
| Chromosome: | chromosome 12 |
| Location: | 8620597 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g547000 | (1 of 1) IPR003442//IPR027417 - tRNA threonylcarbamoyl adenosine modification protein TsaE // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCACTGCGCCCCCCCCCCGACCTGTCCC |
| Internal bar code: | ATATGGGGCTAGTTTGCTCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1181 |
| LEAP-Seq percent confirming: | 96.9531 |
| LEAP-Seq n confirming: | 11487 |
| LEAP-Seq n nonconfirming: | 361 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTACCTGGCGGTCAACATC |
| Suggested primer 2: | TGATCGCTTGCTCTCACAAG |