| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.238055 |
| Chromosome: | chromosome 10 |
| Location: | 2415315 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435550 | DOH1 | Deoxyhypusine hydroxylase/monooxygenase; (1 of 1) 1.14.99.29 - Deoxyhypusine monooxygenase / DOHH | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAACGACATATAAATCCGACGACAGACA |
| Internal bar code: | GGCCGGCACGTGAATCGGTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 863 |
| LEAP-Seq percent confirming: | 99.6015 |
| LEAP-Seq n confirming: | 6999 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACCTCACTCCCCACTCT |
| Suggested primer 2: | CGCATGTCAGCATAACCATC |