| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.238096 |
| Chromosome: | chromosome 2 |
| Location: | 7238670 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145800 | MDN3,MDH3 | NAD-dependent malate dehydrogenase 3; (1 of 1) K00025 - malate dehydrogenase (MDH1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGATGGCCAACCACGGGGCCGTAACCCA |
| Internal bar code: | GCGGCTCCTGAGGGGTAGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 365 |
| LEAP-Seq percent confirming: | 98.9011 |
| LEAP-Seq n confirming: | 90 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGGTGTCGTGGAGTGGAA |
| Suggested primer 2: | TACTCCTACCCCGTCACCTG |