| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.238189 |
| Chromosome: | chromosome 1 |
| Location: | 3089245 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g019150 | GCP4 | (1 of 1) K16571 - gamma-tubulin complex component 4 (TUBGCP4, GCP4); Gamma tubulin interacting protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGTTCAACGCACGCACCAGTCCTGCAT |
| Internal bar code: | TTGGGGAATATTAGGGCGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 538 |
| LEAP-Seq percent confirming: | 99.8252 |
| LEAP-Seq n confirming: | 1142 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCAGTGAACACAAGGCA |
| Suggested primer 2: | TGACGGAGATCTTCCAGGAC |