Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.238328 |
Chromosome: | chromosome 10 |
Location: | 6230986 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g464550 | LAT1 | (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr); Latrunculin-B sensitive 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCTTGCTTAGGGTATGCGGTAGTCAAGT |
Internal bar code: | TCCATCCCAGAAGCAAGCGAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 590 |
LEAP-Seq percent confirming: | 94.2227 |
LEAP-Seq n confirming: | 897 |
LEAP-Seq n nonconfirming: | 55 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTTCCCAAGATACGCAAT |
Suggested primer 2: | ATTAACAACAACCCCCACCA |