| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.238350 |
| Chromosome: | chromosome 12 |
| Location: | 1345671 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488600 | (1 of 1) IPR000104//IPR006059 - Antifreeze protein, type I // Solute-binding family 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAGTATGCGCAAGGCAAGGAAAGAGCA |
| Internal bar code: | GGGTTTCGCCTCGGAGGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 530 |
| LEAP-Seq percent confirming: | 64.0671 |
| LEAP-Seq n confirming: | 879 |
| LEAP-Seq n nonconfirming: | 493 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCGGTGTGATAAACGATG |
| Suggested primer 2: | TCCTATGTGTGCGTGTCCAT |