| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.238396 |
| Chromosome: | chromosome 2 |
| Location: | 7685063 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143151 | SPB | (1 of 5) PF04130 - Spc97 / Spc98 family (Spc97_Spc98); Spindle pole body component | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAGGGTGGGCAACCGTGGAATGGATGGC |
| Internal bar code: | ACCGCCGACTGGGGCCCATTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 98.8971 |
| LEAP-Seq n confirming: | 269 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCACACGACTCTGCATGT |
| Suggested primer 2: | GCATATGAAACGATTGCGTG |