Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.238466 |
Chromosome: | chromosome 1 |
Location: | 1023874 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g005850 | CBA2,FAP23 | Cobalamin adenosyltransferase; (1 of 1) 2.5.1.17 - Cob(I)yrinic acid a,c-diamide adenosyltransferase / Cob(I)alamin adenosyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGGCAAGGGCTAGCAAGGTGGCAAGTGT |
Internal bar code: | CTTCCGCGGCCTGAGAGAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 129 |
LEAP-Seq percent confirming: | 98.9418 |
LEAP-Seq n confirming: | 187 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACGTACGCACACGCAGTT |
Suggested primer 2: | CCCACCTGTCACTCACCTTT |