| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.238466 |
| Chromosome: | chromosome_1 |
| Location: | 1023874 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre01.g005850 | FAP23,CBA2 | Cobalamin adenosyltransferase and Flagellar Associated Protein | antisense | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | AGCGGCAAGGGCTAGCAAGGTGGCAAGTGT |
| Internal bar code: | CTTCCGCGGCCTGAGAGAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 129 |
| LEAP-Seq percent confirming: | 98.9418 |
| LEAP-Seq n confirming: | 187 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACGTACGCACACGCAGTT |
| Suggested primer 2: | CCCACCTGTCACTCACCTTT |