| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.238494 |
| Chromosome: | chromosome 3 |
| Location: | 2322542 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158400 | FAP218 | Flagellar Associated Protein 218; (1 of 1) IPR023160 - Ribonuclease HII, helix-loop-helix cap domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGAGACCGGCCACGACGCGGAGTTGGC |
| Internal bar code: | GGTCCGGACGGCCAACTCACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 215 |
| LEAP-Seq percent confirming: | 99.591 |
| LEAP-Seq n confirming: | 1948 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGCATTACATGAAAAGGT |
| Suggested primer 2: | TTCATGACCGTGCTTGAGAG |