| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.238513 |
| Chromosome: | chromosome 16 |
| Location: | 4061133 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g669900 | FAP399 | Flagellar Associated Protein 399 with Low in Lung Cancer domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACGCGAAGTCCCACAGCACGCCCGTAGC |
| Internal bar code: | CACGCAACTGCCGAGGTCATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 258 |
| LEAP-Seq percent confirming: | 99.5976 |
| LEAP-Seq n confirming: | 495 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAACATCACCGTCACCAC |
| Suggested primer 2: | CTCGCCACTCACTTAGGGTC |