| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.238533 |
| Chromosome: | chromosome 12 |
| Location: | 8867692 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544700 | PUF3 | Puf protein; (1 of 1) PTHR12537:SF13 - SUPPRESSOR PROTEIN MPT5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCGAGAGGTGTACCTGTAGGTCCCAGG |
| Internal bar code: | GAGCCGGTTGGATAGGTCGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 531 |
| LEAP-Seq percent confirming: | 91.129 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCTTGTCCTACTTTCTGC |
| Suggested primer 2: | ACCTGCGCTATGAGACCACT |