Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.238558 |
Chromosome: | chromosome 2 |
Location: | 1858784 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g087400 | ZIL1,ZIP14 | protein of unknown function; (1 of 6) IPR002395 - HMW kininogen | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCCAAAGCTGAGTTCGACTGGCTTCCG |
Internal bar code: | GAGTAGGCCTAGCGCGGGATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 61 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATTTAATGCTTTGCGGTGG |
Suggested primer 2: | CCTCCATCTGGTAGGCATGT |