Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.238571 |
Chromosome: | chromosome 1 |
Location: | 3883225 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g025250 | RFK2 | Riboflavin kinase; (1 of 1) PTHR22749//PTHR22749:SF2 - RIBOFLAVIN KINASE/FMN ADENYLYLTRANSFERASE // RIBOFLAVIN KINASE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATACCGTGCTGCCGCCCGAACACGTGCA |
Internal bar code: | TTGATGTGTGTGCATCGGTCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 508 |
LEAP-Seq percent confirming: | 70.9265 |
LEAP-Seq n confirming: | 222 |
LEAP-Seq n nonconfirming: | 91 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCCTCTTCTTACAACCGC |
Suggested primer 2: | GCAAGCAAGACTCACCTTCC |