Insertion junction: LMJ.RY0402.238696_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.238696
Chromosome:chromosome_10
Location:2321725
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre10.g434800 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CCTCGTATGCACATTTTGCTTCGAACGTTA
Internal bar code:CGGCCTTACAGTGCGGGGGGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:571
LEAP-Seq percent confirming:99.2951
LEAP-Seq n confirming:986
LEAP-Seq n nonconfirming:7
LEAP-Seq n unique pos:15

Suggested primers for confirmation by PCR

Suggested primer 1:TCAGGCGCTACAATGAGATG
Suggested primer 2:CAGGCAAGATGGGAAAGGTA