| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.238715 |
| Chromosome: | chromosome 17 |
| Location: | 3675067 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g726750 | SHK1,SHKA1,DHAPS1 | (1 of 1) 2.5.1.54 - 3-deoxy-7-phosphoheptulonate synthase / Phospho-2-oxo-3-deoxyheptonate aldolase; DHAP synthetase 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGGTGCAGCAGCCCACGTGGTGCGTGTA |
| Internal bar code: | ACGCCCCGCCGGAACATTGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 502 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 315 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCAGCGCTGATCTTGTT |
| Suggested primer 2: | TGCTATGAGGGACCATCTCC |