| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.239040 |
| Chromosome: | chromosome 16 |
| Location: | 3046693 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665100 | CAV3 | Voltage-gated Ca2+ channel, alpha subunit; (1 of 1) IPR000048//IPR005821 - IQ motif, EF-hand binding site // Ion transport domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGACGCCCACGATTTAACTCCTTAACCC |
| Internal bar code: | ATGACACCAGGTATGACGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 714 |
| LEAP-Seq percent confirming: | 99.1936 |
| LEAP-Seq n confirming: | 4674 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGACACGCATTCCCACAT |
| Suggested primer 2: | ACCCAATTATTACGAGGGGG |