| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.239050 |
| Chromosome: | chromosome 2 |
| Location: | 2157373 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g089400 | HRP2 | (1 of 12) 2.7.11.18 - [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase; Hydroxyproline-rich glycoprotein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTAGTGTTCTTGTGTTTGGTCACCTTGG |
| Internal bar code: | GAGGCATGCGGAGAAAGCACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 470 |
| LEAP-Seq percent confirming: | 99.1319 |
| LEAP-Seq n confirming: | 571 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATCCCGAAGTAAGACGAA |
| Suggested primer 2: | CTCTGCAGCTGCTGTCTACG |