| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.239185 |
| Chromosome: | chromosome 12 |
| Location: | 3575759 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g513600 | SGTA,SGTA1 | (1 of 1) K12795 - suppressor of G2 allele of SKP1 (SUGT1, SGT1); Small glutamine-rich tetratricopeptide repeat-containing protein alpha | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCCCGCCCACCTTGCCGTACAGCTCCA |
| Internal bar code: | GAAGTTTGGCTGGCAGTAGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 275 |
| LEAP-Seq percent confirming: | 99.5169 |
| LEAP-Seq n confirming: | 2678 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATGTATGGCCTTCCCTGC |
| Suggested primer 2: | TTGCTCCAGTCCTTTTGCTT |