| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.239195 |
| Chromosome: | chromosome 16 |
| Location: | 7745798 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g691888 | FBP3 | Fructose-2%252C6-bisphosphate 2-phosphatase; (1 of 2) 2.7.1.105 - 6-phosphofructo-2-kinase / Phosphofructokinase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCCAGCGGGTGCTAGAGTCGAGCGTTT |
| Internal bar code: | AGTTGCCCTCGGTGGTGATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 603 |
| LEAP-Seq percent confirming: | 99.2401 |
| LEAP-Seq n confirming: | 653 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCCTTACTTGTATTGGGA |
| Suggested primer 2: | GAAGTGCAGCCTTCCAACTC |