| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.239285 |
| Chromosome: | chromosome 9 |
| Location: | 2090109 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393850 | MAPKKK2,PTK28,MAPKKK2 | Mitogen-Activated Protein Kinase Kinase Kinase; (1 of 1) IPR000719//IPR001229//IPR001245//IPR002290//IPR011009//IPR020635 - Protein kinase domain // Jacalin-like lectin domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCACTCGAGGGCTAGCGCGAACTCACTC |
| Internal bar code: | ATAATGATTTCGTATGTGTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 99.4578 |
| LEAP-Seq n confirming: | 3852 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATGACACACATGTCCAC |
| Suggested primer 2: | CTGCCGACGTGTCAGTAGAA |