Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.239340 |
Chromosome: | chromosome 4 |
Location: | 3484119 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g227850 | (1 of 1) IPR004192//IPR028978 - Ubiquinol cytochrome reductase, transmembrane domain // Chorismate pyruvate-lyase/UbiC transcription regulator-associated domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCGGACCGCTCTGCATGAAGGCAAGTG |
Internal bar code: | CCTTTTAGAGCAGCTGGAACGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 235 |
LEAP-Seq percent confirming: | 98.6667 |
LEAP-Seq n confirming: | 962 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATCACATCCACCTCCTCA |
Suggested primer 2: | GACCACCTGCATCAACACAC |