| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.239363 |
| Chromosome: | chromosome 11 |
| Location: | 2749494 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477150 | (1 of 4) IPR000533 - Tropomyosin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGACGAAATTGGGGCGAGATAGAGAC |
| Internal bar code: | TACGTGTTCCGCTCACGCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 238 |
| LEAP-Seq percent confirming: | 88.7917 |
| LEAP-Seq n confirming: | 3351 |
| LEAP-Seq n nonconfirming: | 423 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCTACGCCTTCACTTCTT |
| Suggested primer 2: | TGTGTGTTGGGTGAAGGAAA |