| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.239385 |
| Chromosome: | chromosome 12 |
| Location: | 2789633 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g502901 | (1 of 3) PF08263//PF13855 - Leucine rich repeat N-terminal domain (LRRNT_2) // Leucine rich repeat (LRR_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGACCCGCTGGGCGCCGTGACGAGCCT |
| Internal bar code: | GTAGGGAAATCCGGGGTAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 532 |
| LEAP-Seq percent confirming: | 97.5197 |
| LEAP-Seq n confirming: | 865 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGACTCAGGCAGAGTTG |
| Suggested primer 2: | CGAAAGAGTTCGAGGACAGG |