Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.239442 |
Chromosome: | chromosome 7 |
Location: | 3859605 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g338800 | CGL125 | (1 of 4) PF04676 - Protein similar to CwfJ C-terminus 2 (CwfJ_C_2); Conserved in the Green Lineage | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATAGGAGCATCTGCGATAGTACGGTAT |
Internal bar code: | GTCATTTTGATTATAATAAAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 630 |
LEAP-Seq percent confirming: | 97.6959 |
LEAP-Seq n confirming: | 212 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATTCAATTGCCTCCAACCC |
Suggested primer 2: | GAGGCTCTTGAGCTTGTGCT |